Último Número: 210 Julio - Setiembre 2018

Diagnóstico parasitológico y molecular de tripanosomiasis canina por Trypanosoma evansi en perros asociados a la caza en dos localidades del Departamento de Artigas, Uruguay

Parasitological and molecular diagnosis of canine trypanosomiasis by Trypanosoma evansi in dogs associated with hunting in two sites of Artigas Department, Uruguay


Autores: Pablo Parodi1, Jorge Freire2, María Teresa Armúa-Fernández3, María Laura Félix 3, Daniel Guerisoli4, Valentin Bazzano3, Luis Carvalho3, José Manuel Venzal3

1Instituto Nacional de Investigación Agropecuaria, Plataforma de Salud Animal, Paysandú, Uruguay. Correspondencia Pablo Parodi: Esta dirección electrónica esta protegida contra spambots. Es necesario activar Javascript para visualizarla

2Laclivet, Laboratorio Clínico Veterinario, Talcahuano 3333, Montevideo, Uruguay.

3Laboratorio de Vectores y enfermedades transmitidas, Facultad de Veterinaria, CENUR Litoral Norte - Salto, Universidad de la República, Rivera 1350, Salto, Uruguay.

4Veterinario de libre ejercicio, Bella Unión, Uruguay.

Recibido: 7 de mayo de 2017   -  Aceptado: 13 de setiembre de 2018

DOI:

Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons

 

ver versión PDF.

Introducción |Materiales y métodos | Resultados | Discusión | Conclusiones | Agradecimientos | Bibliografía |

Resumen

El objetivo del presente trabajo es reportar dos casos autóctonos fatales de tripanosomiasis canina causada por Trypanosoma evansi, enfermedad también conocida como surra, en perros cruza utilizados para la caza provenientes de dos localidades del Departamento de Artigas, Uruguay. Los casos se presentaron en los meses de setiembre y noviembre del 2017. Los signos clínicos fueron anemia, edemas en zona ocular, oral y miembros posteriores, inapetencia y desmejoramiento general progresivo. El diagnóstico se realizó tomando en cuenta signos clínicos y análisis paraclínicos: hemograma, funcional hepático, frotis de sangre y PCR/secuenciación. En los frotis sanguíneos se visualizaron tripomastigotes cuya morfología era compatible con Trypanosoma spp. En hemograma se destaca anemia hipocrómica y trombocitopenia, en el funcional hepático se detectaron altos niveles de enzimas hepáticas (AST/GGT/GOT/Fosfatasa Alcalina). Se realizaron tres PCRs que amplificaron un fragmento parcial del gen ARN ribosomal 18S (ARNr 18S) así como de dos fragmentos solapantes del espaciador transcrito interno ITS (ITS1+5,8S+ITS2). Las secuencias obtenidas tuvieron una homología del 100% para el gen ARNr 18S y del 99% para la región ITS con T. evansi. Estos casos representan el segundo diagnóstico para Uruguay de T. evansi y los primeros reportes de muerte a causa de esta tripanosomiasis en perros para el país. Se trata de una enfermedad a tener en cuenta ya que además de considerarse emergente para el país puede afectar gravemente a otras especies, siendo de notificación a la OIE (Organización Mundial de Sanidad Animal).

 

Palabras claves: Tripanosomiasis canina, surra, anemia, Trypanosoma evansi, Uruguay


Abstract

The aim of this work is to report two fatal autochthonous cases of canine trypanosomiasis caused by Trypanosoma evansi, a disease also known as surra, in cross breed dogs used for hunting from two sites of Artigas Department, Uruguay. The cases appeared in the months of September and November of 2017. The clinical signs were anemia, ocular, oral and posterior limbs edema, inappetence and progressive general deterioration. The diagnosis was made taking into account clinical signs and paraclinical analysis: hemogram, liver function test, blood smear and PCR/sequencing. Blood smears showed trypomastigotes whose morphology was compatible with Trypanosoma spp. In hemogram and liver function test it was noted hypochromic anemia and thrombocytopenia, in addition to high levels of liver enzymes (AST/GGT/GOT/Alkaline Phosphatase). Three PCRs were performed that amplified a partial fragment of the 18S ribosomal RNA gene (18S rRNA) as well as two overlapping fragments of the internal transcribed spacer ITS (ITS1+5.8S+ITS2). The sequences obtained had a homology of 100% for the 18S rRNA gene and 99% for the ITS region with T. evansi. These cases represent the second diagnosis for Uruguay of T. evansi and the first reports of death due to this trypanosomiasis in dogs for the country. It is a disease to be taken into account, since, in addition to being considered emerging disease for the country; it can seriously affect other species, being an OIE (World Organisation for Animal Health) notified disease.

 

Keywords: Canine trypanosomiasis, surra, anemia, Trypanosoma evansi, Uruguay


Introducción

Los tripanosomas de mamíferos (incluido el humano) parasitan sangre y en ocasiones tejidos de estos hospedadores. Son protozoos que pertenecen al orden Kinetoplastida, familia Trypanosomatidae, género Trypanosoma. Son parásitos digenéticos, que cumplen su ciclo de vida en dos hospedadores, un animal vertebrado como hospedador final y diversos invertebrados como hospedadores intermediarios (Aguilar y col., 2002). Los tripanosomas de interés médico-veterinario se agrupan en 2 secciones: Stercoraria, los cuales se desarrollan en la parte posterior del tracto digestivo de los insectos, como por ejemplo Trypanosoma cruzi, responsable de la enfermedad de Chagas, y Salivaria que se desarrollan en la parte anterior del tracto digestivo de insectos (Coura y Borges-Pereira, 2010; Desquesnes y col., 2013). Dentro de los salivarios con importancia sanitaria en América del Sur se encuentran: Trypanosoma evansi, Trypanosoma vivax y Trypanosoma equiperdum.

La tripanosomiasis causada por T. evansi es comúnmente conocida como surra o mal de las caderas, o también como murrina y derrengadera, y afecta una amplia diversidad de mamíferos (CFSPH, 2009; OIE, 2018), siendo potencial zoonótico en el hombre, con un caso reportado en India (Joshi y col., 2005).

Esta especie puede parasitar a la mayoría de los mamíferos domésticos, siendo caballos, perros, camellos y bovinos las especies que enferman con mayor gravedad. Además, también son parasitados una amplia variedad de animales silvestres como por ejemplo el carpincho (Hydrochoerus hydrochaeris) en Sudamérica, el cual es considerado un reservorio (Wells, 1984; CFSPH, 2009; OIE, 2018).

Trypanosoma evansi se encuentra distribuido en regiones tropicales y subtropicales en varios continentes y es transmitido principalmente de forma mecánica por la alimentación de insectos hematófagos como tábanos y moscas del género Stomoxys. Además se ha mencionado la transmisión iatrogénica por agujas o instrumentos quirúrgicos, transmisión oral por lamidos, peleas o por la alimentación de tejidos y sangre infectada, así como por la mordida de murciélagos hematófagos en América. Así mismo, también es posible la transmisión por la leche y por vía venérea (Raina y col., 1985, Singh y col., 2000; CFSPH, 2009; OIE, 2018).

En caninos T. evansi causa una grave enfermedad anemizante. Cuando transcurre en su período agudo provoca fiebre intermitente, inapetencia, caquexia, edemas subcutáneos, letargia, ceguera y alteraciones en la homeostasis. Por otro lado, en su fase crónica hay compromiso del estado general del animal con reagudización de los síntomas (Braccini y col., 2005; Correa-Salgado y col., 2010). En Uruguay, la enfermedad ha sido recientemente reportada en un perro de raza Cimarrón de la ciudad de Rivera, a partir del cual se realizó la caracterización molecular y aislamiento de T. evansi, demostrando la expansión del parásito en nuestro continente (Greif y col., 2018).

El diagnóstico de esta enfermedad se realiza principalmente en base a síntomas clínicos, frotis de sangre y PCR. Otros análisis paraclínicos como hemograma completo, funcional hepático y renal también ayudan a orientar el diagnóstico. Esta tripanosomiasis es de alta letalidad si no se tratan los animales en fases tempranas de la enfermedad (Seidl y col., 2001). La droga de elección utilizada para su tratamiento es Aceturato de Diminaceno a dosis de 3,5-7,0 mg/kg intramuscular (Peregrine, 1994).

En el presente trabajo se reporta el diagnóstico de dos casos fatales de tripanosomiasis canina por T. evansi en perros provenientes de dos localidades del Departamento de Artigas en el noroeste de Uruguay.

(Volver arriba)

 


 

Materiales y métodos

 

Animales del estudio

Dos caninos, un macho (canino 1) de 3 años (28kg) procedente de la ciudad de Bella Unión (30°15’40’’S; 54°36’21’’O) y una hembra (canino 2) de 2 años (25kg) de pueblo Cuareim (30°13’30’’S; 57°34’05’’O), localidades que pertenecen al Departamento de Artigas. Ambos animales eran de raza cruza y utilizados para la caza de jabalí (Sus scrofa). Dicho caninos comenzaron a presentar signos de enfermedad en los meses de setiembre (canino 1) y noviembre (canino 2) del año 2017. Ante el desmejoramiento progresivo de los animales, ambos perros fueron remitidos a una clínica veterinaria particular de la ciudad de Bella Unión, donde se les realizó un examen clínico general.

 

Toma de muestras y análisis paraclínicos

En la clínica se les tomó muestras de sangre con y sin anticoagulante de forma aséptica. Las mismas fueron remitidas para posterior remisión al Laboratorio Clínico Veterinario (Laclivet) en Montevideo para realizar frotis de sangre, hemograma completo en ambos animales y bioquímica al canino 1. Una alícuota de sangre con anticoagulante fue remitida al Laboratorio de Vectores y enfermedades transmitidas (LVyET), CENUR Litoral Norte-Salto, UdelaR, para realizar el diagnóstico molecular.

También se obtuvieron muestras de sangre con anticoagulante de perros que convivían con los dos anteriormente mencionados y realizaban las mismas actividades de cacería. Cuatro perros proceden de la ciudad de Bella Unión y cinco de pueblo Cuareim.

 

Frotis, coloración, morfologías parasitarias

Con la sangre (2 animales enfermos + 9 animales compañeros) se realizaron frotis finos por extensión, fueron fijados con alcohol metílico durante 5 minutos y coloreados con Giemsa durante 2 horas. La visualización de los frotis se realizó bajo objetivo 100x de inmersión. Una vez visualizado el parásito se procedió a la descripción morfométrica de 30 ejemplares.

 

Extracción de ADN, PCR y secuenciación

La extracción de ADN se llevó a cabo utilizando un kit comercial PureLink®Genomic DNA Mini Kit (Invitrogen, Alemania) a partir de 200 µl de sangre fresca siguiendo las instrucciones del fabricante. La concentración de ADN fue cuantificada con un espectrofotómetro Nanodrop 2000 (ThermoScientific). Con el ADN obtenido se realizaron tres PCRs para tripanosomátidos. La primera reacción amplifica una porción de 800 a 900 pb del gen ARNr 18S (Maia da Silva y col., 2004; Ramírez y col., 2012) y fue realizada a todos los perros muestreados (2 animales enfermos + 9 animales compañeros) utilizando los primers 609 F y 706 R (Tabla 1). Como control positivo para esta PCR se utilizó una muestra de ADN de Leishmania infantum.

Posteriormente se realizaron otras dos PCRs que amplificaron fragmentos solapantes de la región del espaciador transcrito interno (ITS1 + 5,8S + ITS2), las cuales se realizaron únicamente a las muestras de los perros clínicamente enfermos (2). En la primera de ellas se utilizaron los primers IR1 - IR2, mientras que en la segunda se emplearon los primers ITS1 CF – ITS1 BR.  Los primeros amplifican 1000 a 1200 pb y los segundos 480 pb (Tabla 1) (Cupolillo y col., 1995; Njiru y col., 2005). El control positivo para ambas PCRs fue Trypanosoma sp.

El producto resultante de cada PCR se visualizó utilizando un transiluminador UV inmediatamente luego de una corrida de electroforesis en gel de agarosa al 1,5%, conteniendo un intercalante GoodView® Nucleic Acid Stain (Beijing SBS Genetech Co., LTd). Los amplicones de tamaño esperado fueron purificados mediante el kit comercial PureLink® Quick PCR Purification kit (Invitrogen, Alemania) y enviados a secuenciar al Instituto Pasteur Montevideo (Uruguay) y Macrogen (Corea del Sur). Las secuencias obtenidas fueron editadas y ensambladas utilizando el programa MEGA 7 (Kumar y col., 2016). Para la determinación de las homologías se compararon con secuencias disponibles en el GenBank mediante la búsqueda BLASTn (http://www.ncbi.nlm.nih.gov/BLAST).

 

Tabla 1. Lista de primers utilizados.

Nombre

Secuencia

Pb amplificadas

Gen/Región

Autor

609 F

CACCCGCGGTAATTCCAGC

800 a 900 pb

ARNr 18S

Maia da Silva y col., 2004; Ramírez y col., 2012

706 R

CTGAGACTGTAACCTCAA

IR1

GCTGTAGGTGAACCTGCAGCAGCTGGATCATT

1000 a 1200 pb

ITS

Cupolillo y col., 1995

IR2

GCGGGTAGTCCTGCCAAACACTCAGGTCTG

ITS1 CF

CCGGAAGTTCACCGATATTG

480 pb

ITS

Njiru y col., 2005

ITS1 BR

TTGCTGCGTTCTTCAACGAA

Nombre: Nombre de los primers. Pb amplificadas: Pares de bases amplificadas luego de la PCR


(Volver arriba)

 


 

Resultados

 

Signos clínicos

Ambos animales presentaron signos similares como decaimiento, inapetencia, linfoadenopatía de ganglios mandibulares, pre-escapulares y poplíteos, adelgazamiento progresivo, salivación, mucosas pálidas, temperatura entre 39,5°C y 39,8°C, secreciones oculares, edemas en zona ocular, oral y más marcado en miembros posteriores. El cuadro clínico en ambos casos fue de larga evolución, durando aproximadamente un mes hasta la muerte de ambos animales. Los dos casos fueron reportados a la OIE (Organización Mundial de Sanidad Animal).

 

Datos hematológicos y bioquímicos

En el hemograma se visualizó una marcada anemia hipocrómica en ambos caninos, con trombocitopenia marcada en el canino 1 (Tabla 2). Al canino 1 además se le realizó un funcional hepático, obteniendo como resultados: concentraciones elevadas de bilirrubina total, directa e indirecta, relación albumina/globulina disminuida, proteínas totales aumentadas, y los perfiles enzimáticos de GPT, GOT y fosfatasa alcalina aumentados (Tabla 2).

 

Tabla 2. Datos de hemograma y bioquímica de los caninos.

 

Hemograma

Canino 1

Canino 2

Unidades

Valores de referencia

Hematíes

3,17

2,15

mil/mm3

5,5 - 8,5

Hemoglobina

8,5

6,1

g/dl

12 – 18

Hematocrito

25

18

%

37 – 55

Plaquetas

50

233

mil/mm3

250 - 500

Leucocitos

13,8

11,3

mil/mm3

6,0 – 17

Neutrófilos

86

66

%

60 – 77

Linfocitos

6

31

%

12 – 30

Monocitos

1

1

%

2 – 10

Eosinófilos

7

2

%

2 – 10

Basófilos

0

0

%

Raros

Funcional Hepático

Bilirrubina Total

5,19

.

mg/dl

Hasta 1,0

Bilirrubina Directa

2,67

.

mg/dl

Hasta 0,0

Bilirrubina Indirecta

2,52

.

mg/dl

Hasta 0,7

Proteínas Totales

8

.

g/dl

5,4 - 7,1

Albúmina

1,6

.

g/dl

2,6 - 3,3

Globulinas

6,4

.

g/dl

2,8 - 3,8

GPT/ALT

280

.

U/L

10 – 60

GOT/AST

86

.

U/L

10 – 60

Fosfatasa Alcalina

2414

.

U/L

Hasta 200

 

Frotis y morfometría de parásitos

En la observación microscópica de los 11 extendidos de sangre, solo en los dos perros clínicamente enfermos se observaron morfologías parasitarias compatibles con tripomastigotes de Trypanosoma sp. (Figura 1). Los mismos poseen un cuerpo ahusado, alargado, de forma tortuosa, con extenso flagelo y núcleo redondeado y central. Las dimensiones tomadas sobre 30 ejemplares por cada perro promediaron 23,3 µm ± 3,4 (min. 17,08 – máx. 29,28) de largo. En los frotis observados de los perros muestreados sin sintomatología no se visualizaron formas parasitarias.

Figura 1. Tripomastigotos de Trypanosoma sp. en frotis de sangre de canino 1 coloreado con Giemsa. Escala = 30 µm (100x).

 

Diagnóstico por PCR y secuenciación

Ambas muestras de los perros clínicamente enfermos fueron positivas tanto para la PCR que amplifica el gen ARNr 18S (Figura 2) como las PCRs que amplificaron los fragmentos solapantes de ambas ITS (Figura 3). Mientras que la PCR que amplifica el gen ARNr 18S en los animales sanos que convivían con los enfermos fueron negativas. De las secuencias editadas se obtuvieron fragmentos de 721pb para el gen ARNr 18S, 1000 y 400 pb para la región ITS. Las secuencias parciales obtenidas de la región ITS se ensamblaron formando una secuencia final de 1175 pb.

El análisis a través de la herramienta BLASTn demostró que las secuencias obtenidas para el gen ARNr 18S tienen una homología del 100% con secuencias correspondientes a T. evansi y T. brucei. Por otro lado, las secuencias ensambladas de los genes ITS tienen una homología del 99% con secuencias correspondientes a T. evansi.

Figura 2. Gel de electroforesis mostrando los amplicones obtenidos luego de la reacción de PCR para amplificar un fragmento del gen ARNr 18S de tripanosomátidos (tamaño de banda esperada ~900 pb). Carril 1 y 6: marcador de peso molecular (100-1500 pb); carril 2: canino 1; carril 3: canino 2; carril 4: control positivo; carril 5: control negativo.

Figura 3. Gel de electroforesis mostrando los amplicones obtenidos luego de las reacciones de PCRs utilizados para detección de las regiones ITS. Carril 1 y 6: marcador de peso molecular (100-1500 pb), carril 2: canino 1, carril 3: canino 2, carril 4: control positivo, carril 5: control negativo (para los primers ITS1 CF y ITS1 BR, tamaño de banda esperada 480 pares de bases), carril, carril 7: canino 1, carril 8: canino 2, carril 9: control positivo, carril 10: control negativo (para los primers IR1 y IR2) tamaño de banda esperada 1000 a 1200 pb), carril 11: marcador de peso molecular (100-3000 pb).

 

(Volver arriba)


 

Discusión

La tripanosomiasis causada por T. evansi es una importante enfermedad que afecta mamíferos domésticos y silvestres en regiones tropicales y subtropicales (CFSPH, 2009). El perro es una de las especies que puede ser seriamente afectada, en el cual predomina un cuadro anemizante, acompañado de fiebre, edema en zona ocular, letargia y adenomegalia generalizada, signos observados en los animales de este estudio y lo reportado por Greif y col. (2018). En el hemograma de ambos perros clínicamente enfermos de este estudio, se constató marcada anemia hipocrómica y trombocitopenia, lo cual es frecuentemente reportado en casos clínicos similares causados por este parásito (Silva y col., 1995). Las posibles causas para la anemia incluyen, supresión eritropoyética, hemodilución, hemólisis y acción directa de los parásitos (Brandão y col., 2002). En cuanto a la trombocitopenia en los perros parasitados, Jain (1993) menciona que es debida a la disminución de la sobrevida de las plaquetas.

Durante el período agudo los animales enfermos presentaron fiebre intermitente, inapetencia, caquexia, edemas subcutáneos, letargia, ceguera y alteraciones en la homeostasis, signos semejantes reportados por Braccini y col. (2005). Por otro lado, en su fase crónica hay compromiso del estado general del animal con reagudización de los síntomas (Braccini y col., 2005; Correa-Salgado y col., 2010). En cuanto a las alteraciones bioquímicas observadas en el canino 1, el aumento de la AST/ALT y Fosfatasa alcalina, probablemente se deba a una necrosis de los hepatocitos por hipoxia, y el aumento de bilirrubina causado por la hemólisis (Meyer y col., 1992). Tanto los signos clínicos como los resultados de los análisis paraclínicos nos indican que los animales estaban cursando la fase crónica de la enfermedad (Brandão y col., 2002). Los perros que enfermaron murieron, coincidiendo con los datos reportados para esta enfermedad que presenta alta letalidad (Seidl y col., 2001).

Desde el punto de vista epidemiológico, ambos casos deben ser considerados autóctonos ya que los caninos eran nacidos y residentes de ambas localidades y sin reportes que hayan salido del país. Según datos recabados, ambos perros eran utilizados para la caza de jabalí en desembocaduras de arroyos en el río Cuareim.

Es probable que la transmisión en ambos casos se produjera durante las cacerías en los montes mediante la picadura de dípteros como tábanos (transmisión mecánica), los cuales son comunes en estos ambientes (Raina y col., 1985). Además, algunos animales silvestres como el carpincho pueden actuar como reservorios, los cuales podrían ser la fuente de infección ya que es una especie presente en esos montes y frecuentemente cazada (Wells, 1984; CFSPH, 2009; OIE, 2018). El resto de los perros muestreados que integraban el grupo de caza junto a los clínicamente enfermos resultaron negativos tanto en los frotis sanguíneos como las PCRs. Teniendo en cuenta que los animales convivían en la misma casa y practicaban las mismas actividades, es probable que la transmisión fuera individual en cada caso mediante la picadura de un díptero insecto hematófago infectado, ya que si fuera por la ingestión de carne o vísceras de algún animal portador del hemoparásito se hubiesen enfermado más perros (Raina y col., 1985; Singh y col., 2000).

En cuanto a la distribución de la enfermedad, en la región se han reportado casos en perros en Los Charrúas, Provincia de Entre Ríos en Argentina (Bono Battistoni y col., 2016) y en Uruguayana, Santana do Livramento y Santa María, tres localidades del Estado de Rio Grande do Sul en Brasil (Braccini y col., 2005; Franciscato y col., 2007; Guim y col., 2013). Para Uruguay la enfermedad ha sido recientemente reportada en un perro de la ciudad de Rivera a partir del cual se realizó la caracterización molecular y aislamiento del parásito (Greif y col., 2018). Por lo tanto, es de esperar que se produzcan nuevos casos en la región.

Como diagnóstico, la visualización de los tripomastigotes de Trypanosoma sp. en los frotis de sangre continúa siendo una forma rápida y económica de realizarlo, en este estudio la longitud promedio fue de 23.3 µm, siendo medidas semejantes a las reportadas por Aguilar y col. (2002). Si además de la observación microscópica se la complementa con técnicas de biología molecular como la PCR, la cual ha demostrado ser una técnica de alta sensibilidad, será de gran ayuda al momento de confirmar esta enfermedad en determinadas regiones o zonas donde no se había registrado anteriormente (Masiga y col., 1992; Desquesnes y Dávila, 2002; Maia da Silva y col., 2004; Njiru y col., 2005; Fernández y col., 2009; Greif y col., 2018).

Es importante destacar que T. evansi pertenece el subgénero Trypanozoon y dentro del clado Trypanosoma brucei que incluye cinco tripanosomas genéticamente muy similares: Trypanosoma brucei brucei, que causa nagana en mamíferos no humanos en la región sub-Sahara de África (Finelle, 1983), Trypanosoma brucei gambienseTrypanosoma brucei rhodesiense, que causan el mal del sueño en humanos en la región sub-Sahara de África (Simarro y col., 2010),  Trypanosoma equiperdum, que causa durina en equinos de vida salvaje (Zablotskij y col., 2003) y T. evansi, causante de surra (mal de cadeiras en Brazil, mal de caderas en Argentina, derrengadera en Venezuela y murrina en América Central) en mamíferos de la región tropical y subtropical (Desquesnes y col., 2013). Es por esto que las secuencias de los animales de este estudio tienen similares homologías con secuencias de T. brucei y T. equiperdum. Lo mismo sucede con la morfología parasitaria, ya que los tripomastigotos de T. evansi, T. brucei y T. equiperdum son indiferenciables (Brun y col., 1998). Por lo tanto es muy importante acompañar el diagnóstico “morfológico” con la situación epidemiológica, ya que por ejemplo T. brucei necesita de las moscas hematófagas tse-tse (Glossina spp.) para su trasmisión y solo se encuentra en África (Masiga y col., 1992), por otro lado T. equiperdum causa una tripanosomiasis que afecta principalmente a equinos y es de trasmisión venérea (Zablotskij y col., 2003). Por otro lado, T. evansi causa importantes pérdidas por mortalidad en equinos, reportado por Seidl y col. (2001), en la zona del Pantanal, Brasil, lo cual se debe estar alerta por eventuales focos de esta enfermedad.

(Volver arriba)

 


 

Conclusiones

Se reportan los dos primeros casos autóctonos fatales de tripanosomiasis canina/surra causados por Trypanosoma evansi, en perros utilizados para la caza provenientes de dos localidades del Departamento de Artigas, Uruguay.

 

(Volver arriba)


 

Agradecimientos

A los propietarios de los perros por colaborar y permitirnos publicar datos de sus animales.

(Volver arriba)

 


 

Referencias

 

 

  1. Aguilar R, Seidl A, Ramirez L, Rivera A. (2002). Trypanosoma evansi y Trypanosoma vivax, biología, diagnóstico y control. Embrapa Pantanal. Corumba. Ministerio de Agricultura, Pecuaria y Abastecimiento.
  2. Bono Battistoni MF, Orcellet V, Peralta JL, Marengo R, Plaza D, Brunini A, Ruiz M, Widenhorn N, Sanchez A, Monje L, Cignetti LF. (2016). First report of Trypanosoma evansi in a canine in Argentina. Vet Parasitol Reg Stud Reports 6: 1-3.
  3. Braccini C, González S, Roulim D, Braccini ET, Braccini G. (2005). Infecção natural por Trypanosoma evansi em cães. Cienc Rural 35: 717-719.
  4. Brandão JP, Larsson MH, Birgel JR, Hagiwara MK, Ventura RM, Teixeira MMG. (2002). Infecção natural pelo Trypanosoma evansi em cão - relato de caso. Clín Vet 36: 23-26.
  5. Brun R, Hecker H, Lun ZR. (1998). Trypanosoma evansi and Trypanosoma equiperdum: distribution, biology, treatment and phylogenetic relationship (a review). Vet Parasitol 79: 95-107.
  6. CFSPH. (2009). Surra. The Center for Food Security and Public Health, Iowa State University. Disponible http://www.cfsph.iastate.edu/Factsheets/pdfs/surra.pdf. Acceso 8 Abril 2010.
  7. Correa-Salgado AM, Pacheco de Araujo FA y Cañon-Franco WA. (2010). Infección natural por Trypanosoma evansi en canino, Manizales-Colombia: Caso clínico. Rev IberoLat Parasitol 69: 98-100.
  8. Coura JR, Borges-Pereira J. (2010). Chagas disease: 100 years after its discovery. A systemic review. Acta Trop 115: 5-13.
  9. Cupolillo E, Grimaldi G Jr., Momen H, Beverley SM. (1995). Intergenic region typing (IRT): A rapid molecular approach to the characterization and evolution of Leishmania. Mol Biochem Parasit 73: 145-155.
  10. Desquesnes M, Dávila AMR. (2002). Applications of PCR-based tools for detection and identification of animal trypanosomes: a review and perspectives. Vet Parasitol 109: 13-231.
  11. Desquesnes M, Holzmuller P, Lai DH, Dargantes A, Lun ZR, Jittaplapong, S. (2013). Trypanosoma evansi and Surra: A Review and Perspectives on Origin, History, Distribution, Taxonomy, Morphology, Hosts, and Pathogenic Effects. Biomed Res Int 2013: 1-22.
  12. Fernández D, González-Baradat B, Eleizalde M, Gonzáles-Marcano E, Perrone T, Mendoza M. (2009). Trypanosoma evansi: A comparison of PCR and parasitological diagnostic tests in experimentally infected mice. Exp Parasitol 121: 1-7.
  13. Finelle P. (1983). Chemoprophylaxis and the raising of trypanotolerant livestock, En: FAO, African animal trypanosomiasis - selected articles from the world animal review, Animal Production and Health Paper. 37 ed. Roma, Ed. FAO pp 1-14.
  14. Franciscato C, Terezinha dos Anjos S, Lopes II, Teixeira MGG, Gonzalez Monteiro S, Wolkmer P, Garmatz BR, Paim CB. (2007). Cão naturalmente infectado por Trypanosoma evansi em Santa Maria, RS, Brasil. Cienc Rural 37: 288-291.
  15. Greif G, Faral-Tello P, Scardoelli Viann C, Hernandez A, Basmadjian Y, Robello C. (2018). The first case report of trypanosomiasis caused by Trypanosoma evansi in Uruguay. Vet Parasitol Reg Stud Reports 11: 19-21.
  16. Guim TN, Guim TN, Correa LFP, Xavier FS, Colpo ETB, Schmitt B, Garmatz SL, Bicca DF y Lavarro W. (2013) Infecção natural por Trypanosoma evansi em cães na região oeste do Rio Grande do Sul: relato de casos. Congresso brasileiro da ANCLIVEPA, 34, Natal, Brasil, pp282-284.
  17. Jain NC. (1993). Essentials of veterinary hematology. Philadelphia, Ed. Lea y Febiger 417 p.
  18. Joshi P, Shegokar V, Powar R, Herder S, Katti R,Salkar H, Dani V, Bhargava A, Jannin J, Truc P. (2005). Human trypanosomiasis caused by Trypanosoma evansi in India: the first case report. Am J Trop Med Hyg 73(3): 491-495.
  19. Kumar S, Stecher G y Tamura K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular biology and evolution: msw054.
  20. Maia da Silva F, Noyes H, .Campaner M, Junqueira ACV, Coura JR, Añez N, Shaw JJ, Stevens JR, Teixeira MMG. (2004). Phylogeny, taxonomy and grouping of Trypanosoma rangeli isolates from man, triatomines and sylvatic mammals from widespread geographical origin based on SSU and ITS ribosomal sequences. Parasitol. 129: 549-561.
  21. Masiga DK, Smyth AJ, Hayes P, Bromidge TJ, Gibson WC. (1992). Sensitive detection of trypanosomes in tsetse flies by DNA amplification. Int J Parasitol 22: 909-918.
  22. Meyer DL, Coles EH, Rich LJ. (1992). Veterinary laboratory medicine: interpretation and diagnosis. Philadephia, Ed. WB Saunders 350 p.
  23. Njiru ZK, Constantine CC, Guya S, Crowther J, Kiragu JM, Thompson RC, Davila AM. (2005). The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes. Parasitol Res 95: 186-192.
  24. OIE. (2018). Trypanosoma evansi infections (including surra). Ficha técnica OIE. Disponible en: http://www.oie.int/fileadmin/Home/eng/Animal_Health_in_the_World/docs/pdf/Disease_cards/TRYPANO_EVANSI.pdf Acceso 8 de Abril 2018.
  25. Peregrine AS. (1994). Chemotherapy and Delivery Systems: Haemoparasites. Vet Parasitol 54: 223-248
  26. Raina AK, Rakesh K, Rajora VS. (1985). Oral transmission of Trypanosoma evansi infection in dogs and mice. Vet Parasitol 18: 67-69.
  27. Ramírez JD, Duque MC, Montilla M, Cucunubá ZM, Guhl F. (2012). Natural and emergent Trypanosoma cruzi I genotypes revealed by mitochondrial (Cytb) and nuclear (SSU rDNA) genetic markers. Exp Parasitol 132: 487-494.
  28. Seidl AF, Moraes AS, Silva RA. (2001). Trypanosoma evansi control and horse mortality in the Brazilian Pantanal. Mem I Oswaldo Cruz 96: 599-602.
  29. Silva RAMS, Herrera HM, Domingos LBS, Ximenes FA, Dávila AMR. (1995). Pathogenesis of Trypanosoma evansi infection in dogs and horses: hematological and clinical aspects. Cienc Rural 25: 223-238.
  30. Simarro PP, Cecchi G, Paone M, Franco JR, Diarra A, Ruiz JA, Fèvre, Courtin F, Mattioli RC, Jannin JG. (2010). The atlas of human African trypanosomiasis: a contribution to global mapping of neglected tropical diseases. Int J Health Geogr 9: 57.
  31. Singh B, Kalra IS, Guptal MP. (2000). Biological and biochemical characterization of isolates of Trypanosoma evansi from Pantanal of Mato Grosso, Brazil. Vet Parasitol 92: 107-118.
  32. Wells EA. (1984). Animal trypanosomiasis in South America. Prev Vet Med 2: 10.
  33. Zablotskij VT, Georgiu C, de Waal T, Clausen PH, Claes F, Touratier L. (2003). The current challenges of dourine: difficulties in differentiating Trypanosoma equiperdum within the subgenus Trypanozoon. Rev Sci Tech 22: 1087-1096.

 

(Volver arriba)